RNA-RNA Interactions: Methods and Protocols by Frank J. Schmidt

By Frank J. Schmidt

In this volumeexpert researchers within the box aspect a number of the equipment that are now favourite to review RNA. those tools are offered as a guidebook to scientists who're skilled with RNA study and need to sweep up on a brand new strategy. Written within the hugely profitable Methods in Molecular Biology sequence layout, chapters contain introductions to their respective subject matters, lists of the mandatory fabrics and reagents, step by step, simply reproducible laboratory protocols, and key pointers on troubleshooting and heading off identified pitfalls.

Thorough and intuitive, RNA-RNA Interactions: tools and Protocols guides scientists investigating organic structures and learning RNA.

Show description

Read or Download RNA-RNA Interactions: Methods and Protocols PDF

Best genetics books

The Genetic Gods: Evolution and Belief in Human Affairs

John Avise provides a overview of latest molecular biology that's rather obtainable to the 'lay' reader with a few previous publicity to the final sector of evolutionary-genetics. The discussions are a bit of philosophically charged (i. e. they don't stay unavoidably technical) and comment on social, emotional, and theological matters too.

Natural Genetic Engineering and Natural Genome Editing (Annals of the New York Academy of Sciences)

The new literature on complete genome sequences presents considerable proof for the motion of traditional genetic engineering in evolution. Discoveries approximately common genetic engineering have coincided with swift development in our figuring out of epigenetic keep an eye on and RNA-directed chromatin formation. precise consciousness should be paid to the position of viruses and comparable so-called "parasitic" components within the foundation of genome formatting and common genetic engineering functions particularly the position of non-random genetic switch operators within the construction of complicated evolutionary innovations.

Evolution and Genetics of Populations. Volume 4: Variability within and among natural populations

"Wright's perspectives approximately inhabitants genetics and evolution are so primary and so accomplished that each severe pupil needs to learn those books firsthand. . . . booklet of this treatise is an important occasion in evolutionary biology. "-Daniel L. Hartl, BioScience

Extra info for RNA-RNA Interactions: Methods and Protocols

Sample text

7. Power supply capable of delivering at least 500 V. 8. UV reflective flexible TLC plates (20 cm × 20 cm) (Whatman 4410 222). 9. Hand-held short-wave UV lamp (Spectroline ENF-240C). 10. Razor blades. 11. Vortexer. 12. ) at all times. 1 RNA Preparation and Purification 1. To perform recursive gene synthesis, mix 1 μL each of DNA oligomers NL-10, NL-11, NL-12, NL-13, NL-14, and NL-15 (10 μM each) in 33 μL of water in a 100 μL thin-walled PCR microcentrifuge tube. 2, item 1 above). Add 5 μL of the 10× recursive gene synthesis buffer, 5 μL of the 10× dNTP mix, and 1 μL of Vent DNA polymerase (New England Biolabs, 5 U/μL).

1). Multiple successive recombinations can be performed in series if desired. 2 DNA Templates 1. Single-stranded DNA oligomers: purchase the following eight oligomers commercially to prepare the wild-type Azoarcus ribozyme by recursive gene synthesis, PCR, and in vitro transcription: ONL-10 (45-mer): CCGGTTTGTGTGACTTTCGCCA CTCCCTGGACTATGCCTTCACCA. 30 Niles Lehman et al. Fig. 2 Tracking of a reaction by the use of 32P. In this case a 152-nt product was recombined using the Azoarcus ribozyme [6].

Frank J. ), RNA-RNA Interactions: Methods and Protocols, Methods in Molecular Biology, vol. 1007/978-1-4939-1896-6_3, © Springer Science+Business Media New York 2015 39 40 B. Cho To minimize the enrichment of undesirable RNA species binding to the Sepharose resin itself, we preselected the RNA pool on the uncoupled Sepharose-adipic acid hydrazide resin. After being passed through the precolumn of Sepharose-adipic acid hydrazide resin, the RNA pool was loaded on the RNA stem-loop attached affinity column.

Download PDF sample

Rated 4.75 of 5 – based on 50 votes