Satellite DNA by Professor Dr. Thengiz Beridze (auth.)

By Professor Dr. Thengiz Beridze (auth.)

The association of genomes in greater organisms has been studied widely lately. With present achievements in gene engineering, it sort of feels really practical that they're going to be in particular transformed within the nearest destiny to provide new, economi­ cally useful types of animals and crops. The luck of those experiments will count enormously at the point of our wisdom of the structural gains of plant and animal DNAs. Comparative experiences of DNA from various organisms all started with discovery of its genetic value within the overdue 1950's. many years later it was once came across that nuclear DNA, the most garage of genetic information,~an encompass a number of fractions vary­ ing in a few actual and chemical homes. besides the "major" DNA, bearing the most load through the genotype functioning, the so-called satellite tv for pc DNAs have been stumbled on. T. G. Beridze, the writer of this publication, is without doubt one of the pioneers within the research of those remarkable DNAs. the result of his experiments with plant satellite tv for pc DNAs have primarily inspired the formation of our present rules on their constitution and prop­ erties.

Show description

Read or Download Satellite DNA PDF

Similar genetics books

The Genetic Gods: Evolution and Belief in Human Affairs

John Avise offers a evaluation of latest molecular biology that is rather available to the 'lay' reader with a few earlier publicity to the final sector of evolutionary-genetics. The discussions are a bit of philosophically charged (i. e. they don't stay unavoidably technical) and comment on social, emotional, and theological concerns too.

Natural Genetic Engineering and Natural Genome Editing (Annals of the New York Academy of Sciences)

The new literature on entire genome sequences offers considerable facts for the motion of traditional genetic engineering in evolution. Discoveries approximately normal genetic engineering have coincided with quick development in our knowing of epigenetic regulate and RNA-directed chromatin formation. particular awareness should be paid to the function of viruses and similar so-called "parasitic" parts within the foundation of genome formatting and common genetic engineering services specifically the function of non-random genetic switch operators within the construction of complicated evolutionary innovations.

Evolution and Genetics of Populations. Volume 4: Variability within and among natural populations

"Wright's perspectives approximately inhabitants genetics and evolution are so primary and so accomplished that each critical pupil needs to research those books firsthand. . . . booklet of this treatise is a massive occasion in evolutionary biology. "-Daniel L. Hartl, BioScience

Extra info for Satellite DNA

Sample text

0----, 560 . cifliilG C T TAT G T A C G GAT G C A AT A AT G U A11 G C T T A AT T C T T C T T G ~ ~ ~ ~ m m .!..! 8T T C TffiilG! AC G CA C C G TG TIAA G GICG TjA AA GILfG ~ m ~ T T C GIA A G GIG A GAG GA TIG G A AIC A GAT C C C G T A C G C A C G G GAG GAG C G C T C A C G Fig. 15. Nucleotide sequence of the pyrimidine-rich regions of Gecarcinus lateralis stDNA (LaMarca et al. 1981). The adjoining Ts or CTs are underlined. The sequences 5' ... CTTT d 5' ... CCTT d h" t b d GAAA ... 5' an GGAA ...

5' 5' ... AATATAT TTATATA ... 5' -60% -40%. The molecule consisting of pentamers is more homogeneous; the stDNA chain consisting of septamers is interspersed with GC pairs though with a lower frequency -less than one GC pair per 50 bp. 3-10· 10 6 daltons. The sequence digested by HaeIII is not included in the basic repeat structures of this satellite (Shen et al. 1976). 672, consists of two types of molecules with closely related repeats (Fry and Brutlag 1979). The molecule consisting oftandemly arranged pentamers comprises 85 % of all the DNA; the other molecule consists of septamer segments: 5' ...

Nucleotide sequence of the pyrimidine-rich regions of Gecarcinus lateralis stDNA (LaMarca et al. 1981). The adjoining Ts or CTs are underlined. The sequences 5' ... CTTT d 5' ... CCTT d h" t b d GAAA ... 5' an GGAA ... 2 Arthropods GACTCTGCCTCACACCGCCGACTGCTACGCAAGCCGCTATGCGGC ATGGCCTGTCGAAAAAACGAAAAC ---G G T-G-G-T-G ---G G T AT-G-G-T-G EXT : RU: TRU: EXT: RU: TRU: +++++++ +++++++ • . +++ 70 ATGCGTACGTTATTAGAATAACG TAAGAACAGG 70 C---I---G-ACAACAGCAAGAGCAGGAACAAGAAC 71 C G-ACAACAAGAAGAGCAGGAACAAGAAC + .

Download PDF sample

Rated 4.09 of 5 – based on 21 votes